Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

Search Page

Filters

My Custom Filters

Publication date

Text availability

Article attribute

Article type

Additional filters

Article Language

Species

Sex

Age

Other

Search Results

4 results

Filters applied: . Clear all
Results are displayed in a computed author sort order. The Publication Date timeline is not available.
Page 1
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ. Rizo-de-la-Torre LC, et al. Among authors: renteria lopez vm. Int J Lab Hematol. 2017 Oct;39(5):539-545. doi: 10.1111/ijlh.12692. Epub 2017 Jun 12. Int J Lab Hematol. 2017. PMID: 28603845
Cell-free plasma microRNAs that identify patients with glioblastoma.
Bustos MA, Rahimzadeh N, Ryu S, Gross R, Tran LT, Renteria-Lopez VM, Ramos RI, Eisenberg A, Hothi P, Kesari S, Barkhoudarian G, Takasumi Y, Cobbs C, Kelly DF, Hoon DSB. Bustos MA, et al. Among authors: renteria lopez vm. Lab Invest. 2022 Jul;102(7):711-721. doi: 10.1038/s41374-021-00720-4. Epub 2022 Jan 10. Lab Invest. 2022. PMID: 35013528 Free article.