Search Page
Save citations to file
Email citations
Send citations to clipboard
Add to Collections
Add to My Bibliography
Create a file for external citation management software
Your saved search
Your RSS Feed
Search Results
4 results
Filters applied: . Clear all
Results are displayed in a computed author sort order.
The Publication Date timeline is not available.
Page 1
A Novel 31.1 kb α-Thalassemia Deletion (- -MEX3) Found in a Mexican Family.
Hemoglobin. 2017 May;41(3):180-184. doi: 10.1080/03630269.2017.1356330. Epub 2017 Aug 9.
Hemoglobin. 2017.
PMID: 28791910
Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.
Rizo-de la Torre LDC, Rentería-López VM, Sánchez-López JY, Magaña-Torres MT, Ibarra-Cortés B, Perea-Díaz FJ.
Rizo-de la Torre LDC, et al. Among authors: renteria lopez vm.
Genet Test Mol Biomarkers. 2021 Mar;25(3):247-252. doi: 10.1089/gtmb.2020.0276.
Genet Test Mol Biomarkers. 2021.
PMID: 33734896
Item in Clipboard
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ.
Rizo-de-la-Torre LC, et al. Among authors: renteria lopez vm.
Int J Lab Hematol. 2017 Oct;39(5):539-545. doi: 10.1111/ijlh.12692. Epub 2017 Jun 12.
Int J Lab Hematol. 2017.
PMID: 28603845
Item in Clipboard
Cell-free plasma microRNAs that identify patients with glioblastoma.
Bustos MA, Rahimzadeh N, Ryu S, Gross R, Tran LT, Renteria-Lopez VM, Ramos RI, Eisenberg A, Hothi P, Kesari S, Barkhoudarian G, Takasumi Y, Cobbs C, Kelly DF, Hoon DSB.
Bustos MA, et al. Among authors: renteria lopez vm.
Lab Invest. 2022 Jul;102(7):711-721. doi: 10.1038/s41374-021-00720-4. Epub 2022 Jan 10.
Lab Invest. 2022.
PMID: 35013528
Free article.
Item in Clipboard
Cite
Cite
ARTICLE TYPE
ARTICLE LANGUAGE
AGE
Filters on the sidebar will be reset to the default list and any currently applied filters will be cleared.