Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

Search Page

Filters

My Custom Filters

Publication date

Text availability

Article attribute

Article type

Additional filters

Article Language

Species

Sex

Age

Other

Search Results

16 results

Filters applied: . Clear all
Results are displayed in a computed author sort order. The Publication Date timeline is not available.
Page 1
Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).
de-la-Cruz-Salcedo EI, Ibarra B, Rizo-de-la-Torre LC, Sánchez-López JY, González-Mercado A, Harteveld CL, Perea-Díaz FJ. de-la-Cruz-Salcedo EI, et al. Int J Lab Hematol. 2016 Oct;38(5):535-42. doi: 10.1111/ijlh.12536. Epub 2016 Jun 24. Int J Lab Hematol. 2016. PMID: 27339814
Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ. Rizo-de-la-Torre LC, et al. Int J Lab Hematol. 2017 Oct;39(5):539-545. doi: 10.1111/ijlh.12692. Epub 2017 Jun 12. Int J Lab Hematol. 2017. PMID: 28603845
Association of polymorphisms of the TNFRSF11B and TNFSF11 genes with bone mineral density in postmenopausal women from western Mexico.
González-Mercado A, Sánchez-López JY, Perea-Díaz FJ, Magaña-Torres MT, Salazar-Páramo M, González-López L, González-Mercado MG, Ibarra-Cortés B. González-Mercado A, et al. Among authors: perea diaz fj. Arch Med Sci. 2019 Sep;15(5):1352-1356. doi: 10.5114/aoms.2019.87410. Epub 2019 Aug 22. Arch Med Sci. 2019. PMID: 31572484 Free PMC article. No abstract available.
Autosomal dominant early onset Alzheimer's disease in the Mexican state of Jalisco: High frequency of the mutation PSEN1 c.1292C>A and phenotypic profile of patients.
Dumois-Petersen S, Gallegos-Arreola MP, Magaña-Torres MT, Perea-Díaz FJ, Ringman JM, Figuera LE. Dumois-Petersen S, et al. Among authors: perea diaz fj. Am J Med Genet C Semin Med Genet. 2020 Dec;184(4):1023-1029. doi: 10.1002/ajmg.c.31865. Epub 2020 Dec 4. Am J Med Genet C Semin Med Genet. 2020. PMID: 33274538
16 results